Uuuuuuuu

In: Other Topics

Submitted By gnelles
Words 655
Pages 3
Biography
Eleanora Fagan was born on April 7, 1915. Some believe her birthplace was Baltimore, Maryland, others think Philadelphia, Pennsylvania. Some reports state the name on her birth certificate read “Elinore Harris”. Regardless of what she was named when she was born, she will always be remembered as Billie Holiday. Holiday was one of the most influential and successful vocalists of her time. Whether through her famous live shows or her timeless recordings, she used her broad voice and melancholy lyrics to captivate her audience between the years 1934 and 1959.
Holiday spent most of her early life in Baltimore. Her mother, Sadie, was just 13 when she gave birth, and her biological father, Clarence Holiday, was non-existent most of her childhood. Sadie married in 1920, which provided some stability in Eleanora’s life. However, Sadie divorced a few years later, leaving Holiday and her mother poor and struggling to make ends meet. With her mother working very long hours, Eleanora was often left in the care of friends and neighbors. With a lack of adult supervision, Holiday often skipped school and got into trouble. In 1925 she was sent to the House of Good Shepherd, a school for troubled African-American girls, where she spent eight months. Throughout her harsh early life, she found consolation in the music of jazz greats like Louis Armstrong and Bessie Smith.
She moved to New York City with her mother in the late 1920s and began performing in local clubs under the name “Billie”, after movie star Billie Dove. John Hammond discovered her while she was performing at a Harlem jazz club when she was 18. She began singing vocals for emerging clarinetist Benny Goodwin. “You’re Mother’s Son-and-Law” was her first commercial release in 1934. She began recording many singles and also dabbled in acting with the film Symphony in Black in 1935. Saxophonist Lester Young…...

Similar Documents

Gene Regulation

... 3/21/05 8:04 PM Page 203 Gene Expression and Regulation 203 (a) P1 O RBS trpL Rho-independent terminator RBS trpE trpD AUG 162 bp mRNA AUG AUG Translation begins before the mRNA is completely synthesized (b) Stop 70 G 2:3 1:2 A U G G C A A C G Pause hairpin U AA G A C G 100 G C U A A A U 90 C C C A A C G U A U A U U A 110 G C C U C G 80 A A C G G C G C Trp Trp Arg Thr Ser Stop G C ... UGGUGGCGCACUUCCUGAAAC GCCUAA ... 60 70 120 C AAGUUCAC Ser C G U 10 U U A Thr C A A A C A Arg G A G 60 C G G Trp G G U U Trp G 20 A Met Lys Ala Ile Phe Val Leu Lys Gly G U CGACAAUGAAAGCAAUUUUCGUACUGAAAGGUU 30 40 50 Pause A G 80 3:4 U G AAU U U G A C A U 120 C G U C G C A C G 130 C C G C 90 G C A AUCAGAUACCCA UUUUUUUU U A 110 140 G C C G 100 G A UAA Fig. 12.16 The features of the leader region of the trp operon. (a) trpL is transcribed into mRNA. (b) The trpL mRNA can form three different stem loop structures depending on the prevalence of charged trp–tRNAs inside the cell (see text and Fig. 12.17 for details). upstream of the signals that control the translation of the trp structural genes. The DNA sequence in this region suggests that the encoded mRNA has a very high probability of forming stem loop secondary structures. There are three combinations of stem loops that can form. They have been named the pause loop (1:2), the terminator loop (3:4), and the anti-terminator loop (2:3) (Fig. 12.16b). Attenuation of the trp operon uses the......

Words: 9991 - Pages: 40

Snap

...Hi fffffffff fffffffffff fff fffff fffff fffff fffffffff ffffffffffff fffffffff ffffffffffff ffffffffff fffffffff ffffffffffffffffff Fffffffffffffff ffffff fffffffffffffff ffffffffffffff fffffffffffffff fffffffffffff ffffffffffff ffffffffffffffffff fffffffffffffffffffffff fffffffffff ffffff ffffffffffff fffffffffff fffffffffuuuuu uuuuuuuu uuuuuuuuu uuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuuuuuuuuu uuuuuuuuuuu uuuuuuuuuuu uuuuiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiittt ttttttttttttttttttt tttttttttttttt tttttttttttttttttttttt tttttttttttttttttttttttttt tttttttttttttttttttttttt ttttttty yyyyyy yyyyyy yyyy yyyyyyyyy yyyyyyy yyyyyy yyy yyyyy yyyyyyyy yyyyyyyy yyyyyyyy yyy yyyyyy yyyyy yyyyyy yyy yyyy Hi fffffffff fffffffffff fff fffff fffff fffff fffffffff ffffffffffff fffffffff ffffffffffff ffffffffff fffffffff ffffffffffffffffff Fffffffffffffff ffffff fffffffffffffff ffffffffffffff fffffffffffffff fffffffffffff ffffffffffff ffffffffffffffffff fffffffffffffffffffffff fffffffffff ffffff ffffffffffff fffffffffff fffffffffuuuuu uuuuuuuu uuuuuuuuu uuuuuuuuu uuuuuuuuuu uuuuuuuuuu uuuuuuuuuuu uuuuuuuuuuu uuuuuuuuuuu uuuuiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiittt ttttttttttttttttttt tttttttttttttt tttttttttttttttttttttt tttttttttttttttttttttttttt tttttttttttttttttttttttt ttttttty yyyyyy yyyyyy yyyy......

Words: 275 - Pages: 2

Liquid Crystal Display

...(half-word RGB565) = 800 columns*600 rows*2 bytes/pixel = 960000 bytes • 24-bit data is stored in a 32-bit field (tossing the high byte for each pixel) Color patterns Digital systems usually stored data in RGB (red-green-blue) colorspace format – Red, green, and blue components are bitfields of a pixel’s color value • Usually referred to as bits per pixel (bpp) – RGB332 – RGB555 – RGB565 – RGB888 8 bbp (Red 3, Green 3, Blue 2) 16 bpp (Red 5, Green 5, Blue 5) 16 bpp (Red 5, Green 6, Blue 5) 24 bpp (Red 8, Green 8, Blue 8) • Organized as a byte in memory as (RRR GGG BB) • Organized as a half-word in memory (U RRRRR GGGGG BBBBB) • Organized as a half-word in memory (RRRRR GGGGGG BBBBB) • Organized as a word (32-bit) in memory – (UUUUUUUU RRRRRRRR GGGGGGGG BBBBBBBB) (U = unused) Frame buffer data to LCD mapping example (16 bpp) Color depth and lookup tables The frame buffer color depth and LCD color depth do not need to be the same – A lookup table can be used to map a small subset to values to LCD color values • For example, controller can be configured for 4bpp while the LCD interface is 16bpp – Allows a selection of 16 colors from a possible 64Kcolors – Colors can be dynamically changed by adjusting the lookup table – Allows a tradeoff for color depth and system bandwidth • 4bpp uses ¼ the bandwidth of 16bpp • Color depths of 8bpp or less require the use of a lookup table – 8bpp requires 256 lookup entries, 4bpp requires 16, etc. – Color index......

Words: 2211 - Pages: 9